Cart 1 Product Products 113,40 € (empty)
-
1 x ATP5SL-ATP...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of LRP12-low density lipoprotein-related protein 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRP12-low density lipoprotein-related protein 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017381 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRP12 |
| Origin species: | Human |
| Product name: | LRP12-low density lipoprotein-related protein 12 Gene |
| Size: | 2ug |
| Accessions: | BC017381 |
| Gene id: | 29967 |
| Gene description: | low density lipoprotein-related protein 12 |
| Synonyms: | ST7; low-density lipoprotein receptor-related protein 12; suppressor of tumorigenicity 7 protein; LDL receptor related protein 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatattctactatgcattaaatcttgaactttataaaacatgtacaaaaattgtacaagataagttccacctggtaatgtctttccctaatacagggttgcgcttgcattggaccctagggatttgcactaaaattatatcaaggtctcagatgagcttagtgcacaagcactatcactttaaatactattatttgctaccacagcaactatatatttccatagcttttggctgggggcgggggacatttttattacaacttgaaattgctttgctggtttcatatttatttgttgtatttaaaaaatacattgttgtaagagtgattttttcaatatattttattcctgggggggatcatgctacactctcaaaagaaaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2-interacting killer (apoptosis-inducing) - collagen triple helix repeat containing 1 - heterogeneous nuclear ribonucleoprotein F - PX domain containing serine/threonine kinase |