CTHRC1-collagen triple helix repeat containing 1 Gene View larger

CTHRC1-collagen triple helix repeat containing 1 Gene

PTXBC014245

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTHRC1-collagen triple helix repeat containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTHRC1-collagen triple helix repeat containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014245
Product type: DNA & cDNA
Ncbi symbol: CTHRC1
Origin species: Human
Product name: CTHRC1-collagen triple helix repeat containing 1 Gene
Size: 2ug
Accessions: BC014245
Gene id: 115908
Gene description: collagen triple helix repeat containing 1
Synonyms: collagen triple helix repeat-containing protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaccccagggccccgccgcctccccgcagcggctccgcggcctcctgctgctcctgctgctgcagctgcccgcgccgtcgagcgcctctgagatccccaaggggaagcaaaaggcgcagctccggcagagggaggtggtggacctgtataatggaatgtgcttacaagggccagcaggagtgcctggtcgagacgggagccctggggccaatggcattccgggtacacctgggatcccaggtcgggatggattcaaaggagaaaagggggaatgtctgagggaaagctttgaggagtcctggacacccaactacaagcagtgttcatggagttcattgaattatggcatagatcttgggaaaattgcggagtgtacatttacaaagatgcgttcaaatagtgctctaagagttttgttcagtggctcacttcggctaaaatgcagaaatgcatgctgtcagcgttggtatttcacattcaatggagctgaatgttcaggacctcttcccattgaagctataatttatttggaccaaggaagccctgaaatgaattcaacaattaatattcatcgcacttcttctgtggaaggactttgtgaaggaattggtgctggattagtggatgttgctatctgggttggcacttgttcagattacccaaaaggagatgcttctactggatggaattcagtttctcgcatcattattgaagaactaccaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein F
- PX domain containing serine/threonine kinase
- lysophosphatidylcholine acyltransferase 2
- apoptosis antagonizing transcription factor

Buy CTHRC1-collagen triple helix repeat containing 1 Gene now

Add to cart