HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene View larger

HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016736
Product type: DNA & cDNA
Ncbi symbol: HNRNPF
Origin species: Human
Product name: HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene
Size: 2ug
Accessions: BC016736
Gene id: 3185
Gene description: heterogeneous nuclear ribonucleoprotein F
Synonyms: HNRPF; OK/SW-cl.23; mcs94-1; heterogeneous nuclear ribonucleoprotein F; HnRNP F protein; nucleolin-like protein mcs94-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgctgggccctgagggaggtgaaggctttgtggtcaagctccgtggcctgccctggtcctgctctgttgaggacgtgcagaacttcctctctgactgcacgattcatgatggggccgcaggtgtccatttcatctacactagagagggcaggcagagtggtgaggcttttgttgaacttggatcagaagatgatgtaaaaatggccctgaaaaaagacagggaaagcatgggacaccggtacattgaggtgttcaggtcccacagaaccgagatggattgggtgttgaagcacagtggtcccaacagtgccgacagcgccaacgatggcttcgtgcggcttcgaggactcccatttggatgcacaaaggaagaaattgttcagttcttctcagggttggaaattgtgccaaacgggatcacattgcctgtggaccccgaaggcaagattacaggggaagcgttcgtgcagtttgcctcgcaggagttagctgagaaggctctagggaaacacaaggagaggatagggcacaggtacattgaggtgtttaagagcagccaggaggaagttaggtcatactcagatccccctctgaagttcatgtccgtgcagcggccagggccctatgaccggcccgggactgccaggaggtacattggcatcgtgaagcaggcaggcctggaaaggatgaggcctggtgcctacagcacaggctacgggggctacgaggagtacagtggcctcagtgatggctacggcttcaccaccgacctgttcgggagagacctcagctactgtctctccggaatgtatgaccacagatacggcgacagtgagttcacagtgcagagcaccacaggccactgtgtccacatgaggggcctgccgtacaaagcgaccgagaacgacatttacaacttcttctctcctctcaaccctgtgagagtccatattgagattggcccagatggaagagtgacgggtgaagcagatgttgagtttgctactcatgaagaagctgtggcagctatgtccaaagacagggccaatatgcagcacagatatatagaactcttcttgaattcaacaacaggggccagcaatggggcgtatagcagccaggtgatgcaaggcatgggggtgtctgctgcccaggccacttacagtggcctggagagccagtcagtgagtggctgttacggggccggctacagtgggcagaacagcatgggtggctatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PX domain containing serine/threonine kinase
- lysophosphatidylcholine acyltransferase 2
- apoptosis antagonizing transcription factor
- heterogeneous nuclear ribonucleoprotein R

Buy HNRNPF-heterogeneous nuclear ribonucleoprotein F Gene now

Add to cart