PXK-PX domain containing serine/threonine kinase Gene View larger

PXK-PX domain containing serine/threonine kinase Gene

PTXBC014479

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PXK-PX domain containing serine/threonine kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PXK-PX domain containing serine/threonine kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014479
Product type: DNA & cDNA
Ncbi symbol: PXK
Origin species: Human
Product name: PXK-PX domain containing serine/threonine kinase Gene
Size: 2ug
Accessions: BC014479
Gene id: 54899
Gene description: PX domain containing serine/threonine kinase
Synonyms: MONaKA; PX domain-containing protein kinase-like protein; PX ser/thr kinase v2; PX serine/threonine kinase; modulator of Na,K-ATPase long form; PX domain containing serine/threonine kinase like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttcatggagaagccgccagccggcaaggtgctgctggacgacacggtgccgctgacagcagccatcgaggcgagccagagcctgcagtcccacacggaatatattattcgagtgcaaagaggaatttctgtggaaaacagctggcagattgttagaagatacagtgactttgatttgcttaacaacagcttacagattgcaggcctaagtctacctcttcctcccaaaaaattgattggtaacatggatcgtgaattcatagctgaaaggcagaaaggtcttcagaactatctcaacgtgatcacaacaaatcatatcttgtctaattgtgagctggttaagaagtttttagatccaaacaactattccgcaaactatactgagattgccttgcaacaggtttccatgttcttccgatcagaaccaaagtgggaggtggtggaacctttgaaagacataggttggagaataaggaagaaatatttcttgatgaagattaaaaatcagccaaaggaacggctagtgttaagctgggctgaccttggcccagacaagtatttgtcagataaagattttcagtgtctaatcaaacttctgccttcttgtttgcacccttacatctatcgggttacctttgccacagctaatgaatcctcagcgttgctaattaggatgtttaacgaaaagggaacattgaaggatctgatctacaaggcaaaaccaaaagacccatttctaaagaagtactgcaaccctaagaagattcagggcctggaactccagcaaataaaaacatatggacggcaaatattagaggtactgaagtttcttcatgacaagggattcccttatgggcatcttcacgcctccaatgtgatgctcgatggggacacttgtcggctgctggaccttgagaattccttattgggcctgccttccttctaccgatcttatttttcacaattcaggaaaatcaatacattggaaagtgtggatgtccactgctttggccacttactgtatgaaatgacttatggacgaccgccagactcggtgcctgtggactccttccctcctgccccgtccatggctgtggtggccgtgttggagtctacgctgtcttgtgaagcctgtaaaaatggcatgcctaccatctcccggctcttacagatgccattattcagcgatgttttactaaccacttctgaaaaaccacagtttaagatccctacaaagttaaaagaggcattgagaattgccaaagaatgtatagagaagagactaattgaggaacagaaacagattcaccagcatcgaagactgacaagagctcagtcccaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lysophosphatidylcholine acyltransferase 2
- apoptosis antagonizing transcription factor
- heterogeneous nuclear ribonucleoprotein R
- ubiquitin-like modifier activating enzyme 2

Buy PXK-PX domain containing serine/threonine kinase Gene now

Add to cart