Login to display prices
Login to display prices
SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene View larger

SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene

PTXBC014098

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene

Proteogenix catalog: PTXBC014098
Ncbi symbol: SNCG
Product name: SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene
Size: 2ug
Accessions: BC014098
Gene id: 6623
Gene description: synuclein, gamma (breast cancer-specific protein 1)
Synonyms: BCSG1; gamma-synuclein; breast cancer-specific gene 1 protein; persyn; synoretin; synuclein, gamma (breast cancer-specific protein 1); synuclein gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgtcttcaagaagggcttctccatcgccaaggagggcgtggtgggtgcggtggaaaagaccaagcagggggtgacggaagcagctgagaagaccaaggagggggtcatgtatgtgggagccaagaccaaggagaatgttgtacagagcgtgacctcagtggccgagaagaccaaggagcaggccaacgccgtgagcgaggctgtggtgagcagcgtcaacactgtggccaccaagaccgtggaggaggcggagaacatcgcggtcacctccggggtggtgcgcaaggaggacttgaggccatctgccccccaacaggagggtgaggcatccaaagagaaagaggaagtggcagaggaggcccagagtgggggagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: