SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene View larger

SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014098
Product type: DNA & cDNA
Ncbi symbol: SNCG
Origin species: Human
Product name: SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene
Size: 2ug
Accessions: BC014098
Gene id: 6623
Gene description: synuclein, gamma (breast cancer-specific protein 1)
Synonyms: BCSG1; gamma-synuclein; breast cancer-specific gene 1 protein; persyn; synoretin; synuclein, gamma (breast cancer-specific protein 1); synuclein gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgtcttcaagaagggcttctccatcgccaaggagggcgtggtgggtgcggtggaaaagaccaagcagggggtgacggaagcagctgagaagaccaaggagggggtcatgtatgtgggagccaagaccaaggagaatgttgtacagagcgtgacctcagtggccgagaagaccaaggagcaggccaacgccgtgagcgaggctgtggtgagcagcgtcaacactgtggccaccaagaccgtggaggaggcggagaacatcgcggtcacctccggggtggtgcgcaaggaggacttgaggccatctgccccccaacaggagggtgaggcatccaaagagaaagaggaagtggcagaggaggcccagagtgggggagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adaptor-related protein complex 1, sigma 1 subunit
- leucine rich repeat containing 8 family, member D
- adaptor-related protein complex 1, sigma 2 subunit
- adaptor-related protein complex 3, sigma 2 subunit

Buy SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene now

Add to cart