Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene
PTXBC014098
New product
Data sheet of SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014098 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNCG |
| Origin species: | Human |
| Product name: | SNCG-synuclein, gamma (breast cancer-specific protein 1) Gene |
| Size: | 2ug |
| Accessions: | BC014098 |
| Gene id: | 6623 |
| Gene description: | synuclein, gamma (breast cancer-specific protein 1) |
| Synonyms: | BCSG1; gamma-synuclein; breast cancer-specific gene 1 protein; persyn; synoretin; synuclein, gamma (breast cancer-specific protein 1); synuclein gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtcttcaagaagggcttctccatcgccaaggagggcgtggtgggtgcggtggaaaagaccaagcagggggtgacggaagcagctgagaagaccaaggagggggtcatgtatgtgggagccaagaccaaggagaatgttgtacagagcgtgacctcagtggccgagaagaccaaggagcaggccaacgccgtgagcgaggctgtggtgagcagcgtcaacactgtggccaccaagaccgtggaggaggcggagaacatcgcggtcacctccggggtggtgcgcaaggaggacttgaggccatctgccccccaacaggagggtgaggcatccaaagagaaagaggaagtggcagaggaggcccagagtgggggagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adaptor-related protein complex 1, sigma 1 subunit - leucine rich repeat containing 8 family, member D - adaptor-related protein complex 1, sigma 2 subunit - adaptor-related protein complex 3, sigma 2 subunit |