TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene View larger

TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005192
Product type: DNA & cDNA
Ncbi symbol: TNFRSF21
Origin species: Human
Product name: TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene
Size: 2ug
Accessions: BC005192
Gene id: 27242
Gene description: tumor necrosis factor receptor superfamily, member 21
Synonyms: BM-018; CD358; tumor necrosis factor receptor superfamily member 21; TNFR-related death receptor 6; death receptor 6; TNF receptor superfamily member 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaattcaactttgagttatcttttaaatatgtcttgtatagttcatattcatggctgaaacttgaccacactattgctgattgtatggttttcacctggacaccgtgtagaatgcttgattacttgtactcttcttatgctaatatgctctgggctggagaaatgaaatcctcaagccatcaggatttgctatttaagtggcttgacaactgggccaccaaagaacttgaacttcaccttttaggatttgagctgttctggaacacattgctgcactttggaaagtcaaaatcaagtgccagtggcgccctttccatagagaatttgcccagctttgctttaaaagatgtcttgttttttatatacacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil-helix-coiled-coil-helix domain containing 2
- N-6 adenine-specific DNA methyltransferase 1 (putative)
- protein phosphatase 1, regulatory (inhibitor) subunit 8
- coiled-coil-helix-coiled-coil-helix domain containing 6

Buy TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene now

Add to cart