MEF2B-myocyte enhancer factor 2B Gene View larger

MEF2B-myocyte enhancer factor 2B Gene

PTXBC010931

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEF2B-myocyte enhancer factor 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MEF2B-myocyte enhancer factor 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010931
Product type: DNA & cDNA
Ncbi symbol: MEF2B
Origin species: Human
Product name: MEF2B-myocyte enhancer factor 2B Gene
Size: 2ug
Accessions: BC010931
Gene id: 4207
Gene description: myocyte enhancer factor 2B
Synonyms: BORCS8-MEF2B readthrough; MEF2BNB-MEF2B readthrough; LOC729991-MEF2B readthrough; MEF2BNB-MEF2B; MEF2B; LOC729991-MEF2B; myocyte enhancer factor 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagccggagatgcagctcaaggggaagaaagtcacggacaagttcactgagagcgtctacgtcctggccaacgaaccatccgtggccctgtaccggctgcaggagcatgtgcgtcgctccctccccgagctggcccagcacaaggcagacatgcagcgttgggaggagcagagccagggagccatctacactgtggagtacgcctgcagcgccgtgaagaacctggtggacagcagcgtctacttccgcagcgtggagggtctgctcaaacaggccatcagcatccgggaccatatgaatgccagtgcccagggccacagcccggaggaaccacccccgccctcctcagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - matrix metallopeptidase 28
- histone acetyltransferase 1
- DEP domain containing 1B
- LMBR1 domain containing 1

Buy MEF2B-myocyte enhancer factor 2B Gene now

Add to cart