Login to display prices
Login to display prices
MEF2B-myocyte enhancer factor 2B Gene View larger

MEF2B-myocyte enhancer factor 2B Gene

PTXBC010931

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEF2B-myocyte enhancer factor 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MEF2B-myocyte enhancer factor 2B Gene

Proteogenix catalog: PTXBC010931
Ncbi symbol: MEF2B
Product name: MEF2B-myocyte enhancer factor 2B Gene
Size: 2ug
Accessions: BC010931
Gene id: 4207
Gene description: myocyte enhancer factor 2B
Synonyms: BORCS8-MEF2B readthrough; MEF2BNB-MEF2B readthrough; LOC729991-MEF2B readthrough; MEF2BNB-MEF2B; MEF2B; LOC729991-MEF2B; myocyte enhancer factor 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagccggagatgcagctcaaggggaagaaagtcacggacaagttcactgagagcgtctacgtcctggccaacgaaccatccgtggccctgtaccggctgcaggagcatgtgcgtcgctccctccccgagctggcccagcacaaggcagacatgcagcgttgggaggagcagagccagggagccatctacactgtggagtacgcctgcagcgccgtgaagaacctggtggacagcagcgtctacttccgcagcgtggagggtctgctcaaacaggccatcagcatccgggaccatatgaatgccagtgcccagggccacagcccggaggaaccacccccgccctcctcagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: