CTD-2267G17.3-X antigen family, member 2-like Gene View larger

CTD-2267G17.3-X antigen family, member 2-like Gene

PTXBC009232

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTD-2267G17.3-X antigen family, member 2-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTD-2267G17.3-X antigen family, member 2-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009232
Product type: DNA & cDNA
Ncbi symbol: CTD-2267G17.3
Origin species: Human
Product name: CTD-2267G17.3-X antigen family, member 2-like Gene
Size: 2ug
Accessions: BC009232
Gene id: 728242
Gene description: X antigen family, member 2-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggcgaggaagatcaacatataggcctaggccaagaagaagtttacagcctcctgagctgattggggctatgcttgaacccactgatgaagagcctaaagaagagaaaccacccactaaaagtcggaatcctacacctgatcagaagagagaagatgatcagggtgcagctgagattcaagtgcctgacctggaagccgatctccaggagctatgtcagacaaagactggggatggatgtgaaggtggtactgatgtcaaggggaagattctaccaaaagcagagcattttaaaatgccagaagcaggtgaagggaaatcacaggtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mal, T-cell differentiation protein-like
- prostaglandin E synthase 3 (cytosolic)
- mannose-P-dolichol utilization defect 1
- splicing factor, arginine/serine-rich 5

Buy CTD-2267G17.3-X antigen family, member 2-like Gene now

Add to cart