Login to display prices
Login to display prices
TMEM126B-transmembrane protein 126B Gene View larger

TMEM126B-transmembrane protein 126B Gene

PTXBC017574

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM126B-transmembrane protein 126B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM126B-transmembrane protein 126B Gene

Proteogenix catalog: PTXBC017574
Ncbi symbol: TMEM126B
Product name: TMEM126B-transmembrane protein 126B Gene
Size: 2ug
Accessions: BC017574
Gene id: 55863
Gene description: transmembrane protein 126B
Synonyms: complex I assembly factor TMEM126B, mitochondrial; HT007; transmembrane protein 126B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcatctatgcatggtcagcccagtccttctctagaagatgcaaaactcagaagaccaatggtcatagaaatcatagaaaaaaattttgactatcttagaaaagaaatgacacaaaatatatatcaaatggcgacatttggaacaacagctggtttctctggaatattctcaaacttcctgttcagacgctgcttcaaggttaaacatgatgctttgaagacatatgcatcattggctacacttccatttttgtctactgttgttactgacaagctttttgtaattgatgctttgtattcaggtgaatttaaattcactaatgtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: