CISD1-CDGSH iron sulfur domain 1 Gene View larger

CISD1-CDGSH iron sulfur domain 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CISD1-CDGSH iron sulfur domain 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CISD1-CDGSH iron sulfur domain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005962
Product type: DNA & cDNA
Ncbi symbol: CISD1
Origin species: Human
Product name: CISD1-CDGSH iron sulfur domain 1 Gene
Size: 2ug
Accessions: BC005962
Gene id: 55847
Gene description: CDGSH iron sulfur domain 1
Synonyms: C10orf70; MDS029; ZCD1; mitoNEET; CDGSH iron-sulfur domain-containing protein 1; zinc finger CDGSH-type domain 1; CDGSH iron sulfur domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtctgacttccagttccagcgtacgagttgaatggatcgcagcagttaccattgctgctgggacagctgcaattggttatctagcttacaaaagattttatgttaaagatcatcgaaataaagctatgataaaccttcacatccagaaagacaaccccaagatagtacatgcttttgacatggaggatttgggagataaagctgtgtactgccgttgttggaggtccaaaaagttcccattctgtgatggggctcacacaaaacataacgaagagactggagacaatgtgggccctctgatcatcaagaaaaaagaaacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myocyte enhancer factor 2B
- matrix metallopeptidase 28
- histone acetyltransferase 1
- DEP domain containing 1B

Buy CISD1-CDGSH iron sulfur domain 1 Gene now

Add to cart