Login to display prices
Login to display prices
PVRL3-poliovirus receptor-related 3 Gene View larger

PVRL3-poliovirus receptor-related 3 Gene

PTXBC017572

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PVRL3-poliovirus receptor-related 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PVRL3-poliovirus receptor-related 3 Gene

Proteogenix catalog: PTXBC017572
Ncbi symbol: PVRL3
Product name: PVRL3-poliovirus receptor-related 3 Gene
Size: 2ug
Accessions: BC017572
Gene id: 25945
Gene description: poliovirus receptor-related 3
Synonyms: PVRL3; CD113; CDW113; NECTIN-3; PPR3; PRR3; PVRR3; nectin 3; poliovirus receptor-related 3; poliovirus receptor-related protein 3; nectin cell adhesion molecule 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaaaaagaatcacaaatagatgttcttcaacaagatgagcttgattcttacccagacagtgtaaaaaaagaaaacaaaaatccagtgaacaatctaatacgtaaagactatttagaagagcctgaaaaaactcagtggaacaatgtagaaaatctcaataggtttgaaagaccaatggattattatgaagatctaaaaatgggaatgaagtttgtcagtgatgaacattatgatgaaaacgaagatgacttagtttcacatgtagatggttccgtaatttccaggagggagtggtatgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: