Login to display prices
Login to display prices
APOA2-apolipoprotein A-II Gene View larger

APOA2-apolipoprotein A-II Gene

PTXBC005282

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOA2-apolipoprotein A-II Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APOA2-apolipoprotein A-II Gene

Proteogenix catalog: PTXBC005282
Ncbi symbol: APOA2
Product name: APOA2-apolipoprotein A-II Gene
Size: 2ug
Accessions: BC005282
Gene id: 336
Gene description: apolipoprotein A-II
Synonyms: Apo-AII; ApoA-II; apoAII; apolipoprotein A-II; apolipoprotein A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggccgaggccaagtcttactttgaaaagtcaaaggagcagctgacacccctgatcaagaaggctggaacggaactggttaacttcttgagctatttcgtggaacttggaacacagcctgccacccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: