APOA2-apolipoprotein A-II Gene View larger

APOA2-apolipoprotein A-II Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOA2-apolipoprotein A-II Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APOA2-apolipoprotein A-II Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005282
Product type: DNA & cDNA
Ncbi symbol: APOA2
Origin species: Human
Product name: APOA2-apolipoprotein A-II Gene
Size: 2ug
Accessions: BC005282
Gene id: 336
Gene description: apolipoprotein A-II
Synonyms: Apo-AII; ApoA-II; apoAII; apolipoprotein A-II; apolipoprotein A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggccgaggccaagtcttactttgaaaagtcaaaggagcagctgacacccctgatcaagaaggctggaacggaactggttaacttcttgagctatttcgtggaacttggaacacagcctgccacccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L5
- prefoldin subunit 4
- nucleoporin 160kDa
- apolipoprotein L, 1

Buy APOA2-apolipoprotein A-II Gene now

Add to cart