RPL5-ribosomal protein L5 Gene View larger

RPL5-ribosomal protein L5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL5-ribosomal protein L5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL5-ribosomal protein L5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001882
Product type: DNA & cDNA
Ncbi symbol: RPL5
Origin species: Human
Product name: RPL5-ribosomal protein L5 Gene
Size: 2ug
Accessions: BC001882
Gene id: 6125
Gene description: ribosomal protein L5
Synonyms: DBA6; MSTP030; PPP1R135; 60S ribosomal protein L5; protein phosphatase 1, regulatory subunit 135; ribosomal protein L5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtttgttaaagttgttaagaataaggcctactttaagagataccaagtgaaatttagaagacgacgagagggtaaaactgattattatgctcggaaacgcttggtgatacaagataaaaataaatacaacacacccaaatacaggatgatagttcgtgtgacaaacagagatatcatttgtcagattgcttatgcccgtatagagggggatatgatagtctgcgcagcgtatgcacacgaactgccaaaatatggtgtgaaggttggcctgacaaattatgctgcagccaagtggaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prefoldin subunit 4
- nucleoporin 160kDa
- apolipoprotein L, 1
- chymotrypsinogen B1

Buy RPL5-ribosomal protein L5 Gene now

Add to cart