Login to display prices
Login to display prices
PFDN4-prefoldin subunit 4 Gene View larger

PFDN4-prefoldin subunit 4 Gene

PTXBC010953

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PFDN4-prefoldin subunit 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PFDN4-prefoldin subunit 4 Gene

Proteogenix catalog: PTXBC010953
Ncbi symbol: PFDN4
Product name: PFDN4-prefoldin subunit 4 Gene
Size: 2ug
Accessions: BC010953
Gene id: 5203
Gene description: prefoldin subunit 4
Synonyms: PFD4; prefoldin subunit 4; prefoldin 4; protein C-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgcttgcagatgatgattgcttaatgataccttatcaaattggtgatgtcttcattagccattctcaagaagaaacgcaagaaatgttagaagaagcaaagaaaaatttgcaagaagaaattgacgccttagaatccagagtggaatcaattcagcgagtgttagcagatttgaaagttcagttgtatgcaaaattcgggagcaacataaaccttgaagctgatgaaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: