PFDN4-prefoldin subunit 4 Gene View larger

PFDN4-prefoldin subunit 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PFDN4-prefoldin subunit 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PFDN4-prefoldin subunit 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010953
Product type: DNA & cDNA
Ncbi symbol: PFDN4
Origin species: Human
Product name: PFDN4-prefoldin subunit 4 Gene
Size: 2ug
Accessions: BC010953
Gene id: 5203
Gene description: prefoldin subunit 4
Synonyms: PFD4; prefoldin subunit 4; prefoldin 4; protein C-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgcttgcagatgatgattgcttaatgataccttatcaaattggtgatgtcttcattagccattctcaagaagaaacgcaagaaatgttagaagaagcaaagaaaaatttgcaagaagaaattgacgccttagaatccagagtggaatcaattcagcgagtgttagcagatttgaaagttcagttgtatgcaaaattcgggagcaacataaaccttgaagctgatgaaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 160kDa
- apolipoprotein L, 1
- chymotrypsinogen B1
- cadherin 19, type 2

Buy PFDN4-prefoldin subunit 4 Gene now

Add to cart