Login to display prices
Login to display prices
NUP160-nucleoporin 160kDa Gene View larger

NUP160-nucleoporin 160kDa Gene

PTXBC009822

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUP160-nucleoporin 160kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUP160-nucleoporin 160kDa Gene

Proteogenix catalog: PTXBC009822
Ncbi symbol: NUP160
Product name: NUP160-nucleoporin 160kDa Gene
Size: 2ug
Accessions: BC009822
Gene id: 23279
Gene description: nucleoporin 160kDa
Synonyms: nucleoporin Nup160; nuclear pore complex protein Nup160; 160 kDa nucleoporin; nucleoporin 160kD; nucleoporin 160kDa; nucleoporin 160
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcgggagccctggaacggagcttcgtggagctaagcggagctgagcgcgaaaggccgaggcactttcgggaattcacagtctgcagcattgggactgcaaatgccgtggctggcgccgtaaaatacagtgaaagcgcgggaggcttttactacgtggagagtggcaagttgttctccgtaaccagaaacaggttcattcattggaagacctctggagatacattggagctgatggaggagtcactggacataaatctgttgaataatgccattcgcctaaaattccaaaattgcagtgttttacctggaggggtttatgtctctgagactcagaatcgtgtgataatcttgatgttaaccaatcaaacagtgcacaggttacttttaccacacccctcccggatgtataggagtgtaagttggctaagtgcaatatcttttatttcccaaattactctgggtgtcacaaatgtagtgctggagcgatgtcttttggaattgaaggaaatttggattctcgttatccctcaccaagcatactttgatagctaccgcttaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: