ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene View larger

ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010395
Product type: DNA & cDNA
Ncbi symbol: ATP6AP2
Origin species: Human
Product name: ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene
Size: 2ug
Accessions: BC010395
Gene id: 10159
Gene description: ATPase, H+ transporting, lysosomal accessory protein 2
Synonyms: APT6M8-9; ATP6IP2; ATP6M8-9; ELDF10; HT028; M8-9; MRXE; MRXSH; MSTP009; PRR; RENR; XMRE; XPDS; renin receptor; ATPase H(+)-transporting lysosomal-interacting protein 2; ATPase, H+ transporting, lysosomal (vacuolar proton pump) membrane sector associated protein M8-9; ATPase, H+ transporting, lysosomal accessory protein 2; ATPase, H+ transporting, lysosomal interacting protein 2; ER-localized type I transmembrane adaptor; N14F; V-ATPase M8.9 subunit; embryonic liver differentiation factor 10; prorenin receptor; renin/prorenin receptor; vacuolar ATP synthase membrane sector-associated protein M8-9; vacuolar proton ATP synthase membrane sector associated protein M8-9; ATPase H+ transporting accessory protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacagtctttatggtgggaatgcagtggtagagttagtcactgtcaagtcatttgacacctccctcattaggaagacaaggactatccttgaggcaaaacaagcgaacccagcaagtccctataaccttgcatataagtataattttgaatattccgtggttttcaacatggtactttggataatgatcgccttggccttggctgtgattatcacctcttacaatatttggaacatggatcctggatatgatagcatcatttataggatgacaaaccagaagattcgaatggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 21
- coiled-coil-helix-coiled-coil-helix domain containing 2
- N-6 adenine-specific DNA methyltransferase 1 (putative)
- protein phosphatase 1, regulatory (inhibitor) subunit 8

Buy ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene now

Add to cart