Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene
PTXBC010395
New product
Data sheet of ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010395 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6AP2 |
| Origin species: | Human |
| Product name: | ATP6AP2-ATPase, H+ transporting, lysosomal accessory protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC010395 |
| Gene id: | 10159 |
| Gene description: | ATPase, H+ transporting, lysosomal accessory protein 2 |
| Synonyms: | APT6M8-9; ATP6IP2; ATP6M8-9; ELDF10; HT028; M8-9; MRXE; MRXSH; MSTP009; PRR; RENR; XMRE; XPDS; renin receptor; ATPase H(+)-transporting lysosomal-interacting protein 2; ATPase, H+ transporting, lysosomal (vacuolar proton pump) membrane sector associated protein M8-9; ATPase, H+ transporting, lysosomal accessory protein 2; ATPase, H+ transporting, lysosomal interacting protein 2; ER-localized type I transmembrane adaptor; N14F; V-ATPase M8.9 subunit; embryonic liver differentiation factor 10; prorenin receptor; renin/prorenin receptor; vacuolar ATP synthase membrane sector-associated protein M8-9; vacuolar proton ATP synthase membrane sector associated protein M8-9; ATPase H+ transporting accessory protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacagtctttatggtgggaatgcagtggtagagttagtcactgtcaagtcatttgacacctccctcattaggaagacaaggactatccttgaggcaaaacaagcgaacccagcaagtccctataaccttgcatataagtataattttgaatattccgtggttttcaacatggtactttggataatgatcgccttggccttggctgtgattatcacctcttacaatatttggaacatggatcctggatatgatagcatcatttataggatgacaaaccagaagattcgaatggattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor receptor superfamily, member 21 - coiled-coil-helix-coiled-coil-helix domain containing 2 - N-6 adenine-specific DNA methyltransferase 1 (putative) - protein phosphatase 1, regulatory (inhibitor) subunit 8 |