Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIGD1A-HIG1 domain family, member 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIGD1A-HIG1 domain family, member 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000601 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIGD1A |
| Origin species: | Human |
| Product name: | HIGD1A-HIG1 domain family, member 1A Gene |
| Size: | 2ug |
| Accessions: | BC000601 |
| Gene id: | 25994 |
| Gene description: | HIG1 domain family, member 1A |
| Synonyms: | HIG1; RCF1a; HIG1 domain family member 1A, mitochondrial; HIG1 domain family, member 1A; RCF1 homolog A; hypoxia inducible gene 1; hypoxia-inducible gene 1 protein; HIG1 hypoxia inducible domain family member 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaacagacacaggtgtttcccttccttcatatgaggaagatcagggatcaaaactcattcgaaaagctaaagaggcaccattcgtacccgttggaatagcgggttttgcagcaattgttgcatatggattatataaactgaagagcaggggaaatactaaaatgtccattcatctgatccacatgcgtgtggcagcccaaggctttgttgtaggagcaatgactgttggtatgggctattccatgtatcgggaattctgggcaaaacctaagccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger family member 673 - gamma-glutamyl cyclotransferase - hypothetical protein HSPC152 - p53 and DNA damage regulated 1 |