HSPC152-hypothetical protein HSPC152 Gene View larger

HSPC152-hypothetical protein HSPC152 Gene

PTXBC017172

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPC152-hypothetical protein HSPC152 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSPC152-hypothetical protein HSPC152 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017172
Product type: DNA & cDNA
Ncbi symbol: HSPC152
Origin species: Human
Product name: HSPC152-hypothetical protein HSPC152 Gene
Size: 2ug
Accessions: BC017172
Gene id: 51504
Gene description: hypothetical protein HSPC152
Synonyms: HSPC152; HSPC170; TRM112; TRMT11-2; hTrm112; multifunctional methyltransferase subunit TRM112-like protein; TRM112-like protein; tRNA methyltransferase 112 homolog; tRNA methyltransferase 11-2 homolog (S. cerevisiae)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaactgcttacccacaatctgctgagctcgcatgtgcggggggtggggtcccgtggcttccccctgcgcctccaggccaccgaggtccgtatctgccctgtggaattcaaccccaacttcgtggcgcgtatgatacctaaagtggagtggtcggcgttcctggaggcggccgataacttgcgtctgatccaggtgccgaaagggccggttgagggatatgaggagaatgaggagtttctgaggaccatgcaccacctgctgctggaggtggaagtgatagagggcaccctgcagtgcccggaatctggacgtatgttccccatcagccgcgggatccccaacatgctgctgagtgaagaggaaactgagagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - p53 and DNA damage regulated 1
- ribosomal protein L26-like 1
- allograft inflammatory factor 1
- SAR1 homolog A (S. cerevisiae)

Buy HSPC152-hypothetical protein HSPC152 Gene now

Add to cart