Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SAR1A-SAR1 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SAR1A-SAR1 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003658 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SAR1A |
| Origin species: | Human |
| Product name: | SAR1A-SAR1 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC003658 |
| Gene id: | 56681 |
| Gene description: | SAR1 homolog A (S. cerevisiae) |
| Synonyms: | SAR1a gene homolog 1; GTP-binding protein SAR1a; SAR1; SARA1; Sara; masra2; COPII-associated small GTPase; SAR1 gene homolog A; SAR1 homolog A; secretion associated Ras related GTPase 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctttcatctttgagtggatctacaatggcttcagcagtgtgctccagttcctaggactgtacaagaaatctggaaaacttgtattcttaggtttggataatgcaggcaaaaccactcttcttcacatgctcaaagatgacagattgggccaacatgttccaacactacatccgacatcagaagagctaacaattgctggaatgacctttacaacttttgatcttggtgggcacgagcaagcacgtcgcgtttggaaaaattatctcccagcaattaatgggattgtctttctggtggactgtgcagatcattctcgcctcgtggaatccaaagttgagcttaatgctttaatgactgatgaaacaatatccaatgtgccaatccttatcttgggtaacaaaattgacagaacagatgcaatcagtgaagaaaaactccgtgagatatttgggctttatggacagaccacaggaaaggggaatgtgaccctgaaggagctgaatgctcgccccatggaagtgttcatgtgcagtgtgctcaagaggcaaggttacggcgagggtttccgctggctctcccagtatattgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutathione S-transferase pi 1 - Alstrom syndrome 1 pseudogene - glutathione transferase zeta 1 - sorting nexin family member 27 |