SAR1A-SAR1 homolog A (S. cerevisiae) Gene View larger

SAR1A-SAR1 homolog A (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAR1A-SAR1 homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAR1A-SAR1 homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003658
Product type: DNA & cDNA
Ncbi symbol: SAR1A
Origin species: Human
Product name: SAR1A-SAR1 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003658
Gene id: 56681
Gene description: SAR1 homolog A (S. cerevisiae)
Synonyms: SAR1a gene homolog 1; GTP-binding protein SAR1a; SAR1; SARA1; Sara; masra2; COPII-associated small GTPase; SAR1 gene homolog A; SAR1 homolog A; secretion associated Ras related GTPase 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttcatctttgagtggatctacaatggcttcagcagtgtgctccagttcctaggactgtacaagaaatctggaaaacttgtattcttaggtttggataatgcaggcaaaaccactcttcttcacatgctcaaagatgacagattgggccaacatgttccaacactacatccgacatcagaagagctaacaattgctggaatgacctttacaacttttgatcttggtgggcacgagcaagcacgtcgcgtttggaaaaattatctcccagcaattaatgggattgtctttctggtggactgtgcagatcattctcgcctcgtggaatccaaagttgagcttaatgctttaatgactgatgaaacaatatccaatgtgccaatccttatcttgggtaacaaaattgacagaacagatgcaatcagtgaagaaaaactccgtgagatatttgggctttatggacagaccacaggaaaggggaatgtgaccctgaaggagctgaatgctcgccccatggaagtgttcatgtgcagtgtgctcaagaggcaaggttacggcgagggtttccgctggctctcccagtatattgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase pi 1
- Alstrom syndrome 1 pseudogene
- glutathione transferase zeta 1
- sorting nexin family member 27

Buy SAR1A-SAR1 homolog A (S. cerevisiae) Gene now

Add to cart