ALMS1P-Alstrom syndrome 1 pseudogene Gene View larger

ALMS1P-Alstrom syndrome 1 pseudogene Gene

PTXBC014492

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALMS1P-Alstrom syndrome 1 pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALMS1P-Alstrom syndrome 1 pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014492
Product type: DNA & cDNA
Ncbi symbol: ALMS1P
Origin species: Human
Product name: ALMS1P-Alstrom syndrome 1 pseudogene Gene
Size: 2ug
Accessions: BC014492
Gene id: 200420
Gene description: Alstrom syndrome 1 pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccatgaaggagtttcctggtttgttcctttggaaaatgtggagtctagataaaaagaaggaaaacatgctcaagactcatgaccctggcatctcccggttggaaccagtaaccaagaccaagccgtggagggagccactgtgggagcggaactggcaggggcagcacctggacagtcggggctacctggcaggcccaggcagagaggatggcagaaacccactgaagctgtttgtgagagcaaccctgcaggaatcgcttcagtttcacagacctgacttcatctcccacatttgggagcggataaagcgtctgaagttaatagtccaggagagaaagctgcagagcatgttaaagagcgagcgggatgcgctattcgacattgacagggaacggcagggccaccagaatcgcatgcgcccactacccaagagagtcttcctggctgtccagaagaacaagcctatcagcaagaaggaaatgattcagaggtccaaacggacacacgcaggaggaacagtagcacaaaggcttcccggtgccttgtgggtgaaagaaaggcttccagggaaaggagagaaacacccagggatcccggtgacgtcgggaagcagcacccagaccatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione transferase zeta 1
- sorting nexin family member 27
- ribulose-5-phosphate-3-epimerase
- linker for activation of T cells

Buy ALMS1P-Alstrom syndrome 1 pseudogene Gene now

Add to cart