GSTP1-glutathione S-transferase pi 1 Gene View larger

GSTP1-glutathione S-transferase pi 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTP1-glutathione S-transferase pi 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GSTP1-glutathione S-transferase pi 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010915
Product type: DNA & cDNA
Ncbi symbol: GSTP1
Origin species: Human
Product name: GSTP1-glutathione S-transferase pi 1 Gene
Size: 2ug
Accessions: BC010915
Gene id: 2950
Gene description: glutathione S-transferase pi 1
Synonyms: GSTP1-1; DFN7; FAEES3; GST3; GSTP; HEL-S-22; glutathione S-transferase P; GST class-pi; deafness, X-linked 7; epididymis secretory protein Li 22; fatty acid ethyl ester synthase III; glutathione S-transferase pi 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgccctacaccgtggtctatttcccagttcgaggccgctgcgcggccctgcgcatgctgctggcagatcagggccagagctggaaggaggaggtggtgaccgtggagacgtggcaggagggctcactcaaagcctcctgcctatacgggcagctccccaagttccaggacggagacctcaccctgtaccagtccaataccatcctgcgtcacctgggccgcacccttgggctctatgggaaggaccagcaggaggcagccctggtggacatggtgaatgacggcgtggaggacctccgctgcaaatacgtctccctcatctacaccaactatgaggcgggcaaggatgactatgtgaaggcactgcccgggcaactgaagccttttgagaccctgctgtcccagaaccagggaggcaagaccttcattgtgggagaccagatctccttcgctgactacaacctgctggacttgctgctgatccatgaggtcctagcccctggctgcctggatgcgttccccctgctctcagcatatgtggggcgcctcagcgcccggcccaagctcaaggccttcctggcctcccctgagtacgtgaacctccccatcaatggcaacgggaaacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Alstrom syndrome 1 pseudogene
- glutathione transferase zeta 1
- sorting nexin family member 27
- ribulose-5-phosphate-3-epimerase

Buy GSTP1-glutathione S-transferase pi 1 Gene now

Add to cart