Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GSTP1-glutathione S-transferase pi 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTP1-glutathione S-transferase pi 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010915 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTP1 |
| Origin species: | Human |
| Product name: | GSTP1-glutathione S-transferase pi 1 Gene |
| Size: | 2ug |
| Accessions: | BC010915 |
| Gene id: | 2950 |
| Gene description: | glutathione S-transferase pi 1 |
| Synonyms: | GSTP1-1; DFN7; FAEES3; GST3; GSTP; HEL-S-22; glutathione S-transferase P; GST class-pi; deafness, X-linked 7; epididymis secretory protein Li 22; fatty acid ethyl ester synthase III; glutathione S-transferase pi 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgccctacaccgtggtctatttcccagttcgaggccgctgcgcggccctgcgcatgctgctggcagatcagggccagagctggaaggaggaggtggtgaccgtggagacgtggcaggagggctcactcaaagcctcctgcctatacgggcagctccccaagttccaggacggagacctcaccctgtaccagtccaataccatcctgcgtcacctgggccgcacccttgggctctatgggaaggaccagcaggaggcagccctggtggacatggtgaatgacggcgtggaggacctccgctgcaaatacgtctccctcatctacaccaactatgaggcgggcaaggatgactatgtgaaggcactgcccgggcaactgaagccttttgagaccctgctgtcccagaaccagggaggcaagaccttcattgtgggagaccagatctccttcgctgactacaacctgctggacttgctgctgatccatgaggtcctagcccctggctgcctggatgcgttccccctgctctcagcatatgtggggcgcctcagcgcccggcccaagctcaaggccttcctggcctcccctgagtacgtgaacctccccatcaatggcaacgggaaacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Alstrom syndrome 1 pseudogene - glutathione transferase zeta 1 - sorting nexin family member 27 - ribulose-5-phosphate-3-epimerase |