Login to display prices
Login to display prices
PDRG1-p53 and DNA damage regulated 1 Gene View larger

PDRG1-p53 and DNA damage regulated 1 Gene

PTXBC009334

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDRG1-p53 and DNA damage regulated 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDRG1-p53 and DNA damage regulated 1 Gene

Proteogenix catalog: PTXBC009334
Ncbi symbol: PDRG1
Product name: PDRG1-p53 and DNA damage regulated 1 Gene
Size: 2ug
Accessions: BC009334
Gene id: 81572
Gene description: p53 and DNA damage regulated 1
Synonyms: C20orf126; p53 and DNA damage-regulated protein 1; p53 and DNA damage regulated 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctatcacccgaggcagagcgagtgctgcggtaccttgtagaagtggaggagctcgccgaggaggtgctggcggacaagcggcagattgtggacctggacactaaaaggaatcagaatcgagagggcctgagggccctgcagaaggatctcagcctctctgaagatgtgatggtttgcttcgggaacatgtttatcaagatgcctcaccctgagacaaaggaaatgattgaaaaagatcaagatcatctggataaagaaatagaaaaactgcggaagcaacttaaagtgaaggtcaaccgcctttttgaggcccaaggcaaaccggagctgaagggttttaacttgaaccccctcaaccaggatgagcttaaagctctcaaggtcatcttgaaaggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: