PDRG1-p53 and DNA damage regulated 1 Gene View larger

PDRG1-p53 and DNA damage regulated 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDRG1-p53 and DNA damage regulated 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDRG1-p53 and DNA damage regulated 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009334
Product type: DNA & cDNA
Ncbi symbol: PDRG1
Origin species: Human
Product name: PDRG1-p53 and DNA damage regulated 1 Gene
Size: 2ug
Accessions: BC009334
Gene id: 81572
Gene description: p53 and DNA damage regulated 1
Synonyms: C20orf126; p53 and DNA damage-regulated protein 1; p53 and DNA damage regulated 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctatcacccgaggcagagcgagtgctgcggtaccttgtagaagtggaggagctcgccgaggaggtgctggcggacaagcggcagattgtggacctggacactaaaaggaatcagaatcgagagggcctgagggccctgcagaaggatctcagcctctctgaagatgtgatggtttgcttcgggaacatgtttatcaagatgcctcaccctgagacaaaggaaatgattgaaaaagatcaagatcatctggataaagaaatagaaaaactgcggaagcaacttaaagtgaaggtcaaccgcctttttgaggcccaaggcaaaccggagctgaagggttttaacttgaaccccctcaaccaggatgagcttaaagctctcaaggtcatcttgaaaggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L26-like 1
- allograft inflammatory factor 1
- SAR1 homolog A (S. cerevisiae)
- glutathione S-transferase pi 1

Buy PDRG1-p53 and DNA damage regulated 1 Gene now

Add to cart