Login to display prices
Login to display prices
ZNF673-zinc finger family member 673 Gene View larger

ZNF673-zinc finger family member 673 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF673-zinc finger family member 673 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF673-zinc finger family member 673 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012569
Product type: DNA & cDNA
Ncbi symbol: ZNF673
Origin species: Human
Product name: ZNF673-zinc finger family member 673 Gene
Size: 2ug
Accessions: BC012569
Gene id: 55634
Gene description: zinc finger family member 673
Synonyms: ZNF673; KRAB domain-containing protein 4; KRAB box domain-containing protein 4; zinc finger family member 673; zinc finger protein 673; KRAB box domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatgtcccaggaatcattgaccttcaaggacgtgtttgtggacttcaccctggaggagtggcagcaactggactctgcccagaagaacctctacagggatgtcatgcttgagaactacagccacctggtgtccgtggggtatctagttgcgaagccagatgtgatcttcaggttgggaccaggtgaagagtcctggatggcagatggggggaccccggtacggacctgtgcaggtgaggacaggccagatgtatccatttttgcctcatgtattttgaagtgctgttattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-glutamyl cyclotransferase
- hypothetical protein HSPC152
- p53 and DNA damage regulated 1
- ribosomal protein L26-like 1