Login to display prices
Login to display prices
ZNF626-zinc finger protein 626 Gene View larger

ZNF626-zinc finger protein 626 Gene

PTXBC007116

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF626-zinc finger protein 626 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF626-zinc finger protein 626 Gene

Proteogenix catalog: PTXBC007116
Ncbi symbol: ZNF626
Product name: ZNF626-zinc finger protein 626 Gene
Size: 2ug
Accessions: BC007116
Gene id: 199777
Gene description: zinc finger protein 626
Synonyms: zinc finger protein 626; CTC-513N18.7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaccattgcaatttagagatgtggccatagaattctctctggaggagtggcattgcctggacactgcacagcggaatttatataggaatgtgatgttagagaactacagtaacctggtcttccttggtattactgtttctaagccagacctgatcacctgtctggagcaaggaagaaaacctttgaccatgaagagaaatgagatgatagccaaaccctcagtgagcttccttcaagttcacagtgagagccaaagtcctcttcatgacatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: