UFM1-ubiquitin-fold modifier 1 Gene View larger

UFM1-ubiquitin-fold modifier 1 Gene

PTXBC005193

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UFM1-ubiquitin-fold modifier 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UFM1-ubiquitin-fold modifier 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005193
Product type: DNA & cDNA
Ncbi symbol: UFM1
Origin species: Human
Product name: UFM1-ubiquitin-fold modifier 1 Gene
Size: 2ug
Accessions: BC005193
Gene id: 51569
Gene description: ubiquitin-fold modifier 1
Synonyms: BM-002; C13orf20; ubiquitin-fold modifier 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaaggtttcctttaagatcacgctgacgtcggacccacggctgccgtacaaagtactcagtgttcctgaaagtacacctttcacagcagtcttaaagtttgcagcagaagaatttaaagttcctgctgcaacaagtgcaattattaccaatgatggaataggaataaatcctgcacagactgctggaaatgtttttctaaaacatggttcagaactgcggattattcctagagatcgtgttggaagttgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 626
- HERV-H LTR-associating 3
- zinc finger protein 587
- ring finger protein 111

Buy UFM1-ubiquitin-fold modifier 1 Gene now

Add to cart