Login to display prices
Login to display prices
RPS27L-ribosomal protein S27-like Gene View larger

RPS27L-ribosomal protein S27-like Gene

PTXBC003667

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS27L-ribosomal protein S27-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS27L-ribosomal protein S27-like Gene

Proteogenix catalog: PTXBC003667
Ncbi symbol: RPS27L
Product name: RPS27L-ribosomal protein S27-like Gene
Size: 2ug
Accessions: BC003667
Gene id: 51065
Gene description: ribosomal protein S27-like
Synonyms: 40S ribosomal protein S27-like; ribosomal protein S27 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctttggctagagatttactacatccgtccttggaagaggaaaagaaaaaacataaagagaaacgcctagtacaaagtccaaattcttactttatggatgtaaaatgtccaggttgctacaagatcaccacggttttcagccatgctcagacagtggttctttgtgtaggttgttcaacagtgttgtgccagcctacaggaggaaaggccagactcacagaagggtgttcatttagaagaaagcaacactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: