MGC15634-hypothetical protein MGC15634 Gene View larger

MGC15634-hypothetical protein MGC15634 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC15634-hypothetical protein MGC15634 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC15634-hypothetical protein MGC15634 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007286
Product type: DNA & cDNA
Ncbi symbol: MGC15634
Origin species: Human
Product name: MGC15634-hypothetical protein MGC15634 Gene
Size: 2ug
Accessions: BC007286
Gene id: 84841
Gene description: hypothetical protein MGC15634
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgacctgctttccatgtctcaaaacattagtccctacaagaaccctatgaggtttatcttcttttcacccattttgagagaagaaaagttcagctcagagagctgcaggaacattggggacatctccaagtcacagccaataggtggcagtcatcagtgtgtcttggaagggacaaacattgagcttctgaacagctactccagaaactatggtgctgtggtgaagtcctggttaggagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC16121
- S100 calcium binding protein A1
- S100 calcium binding protein A4
- endothelial PAS domain protein 1

Buy MGC15634-hypothetical protein MGC15634 Gene now

Add to cart