HIST1H2BJ-histone cluster 1, H2bj Gene View larger

HIST1H2BJ-histone cluster 1, H2bj Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H2BJ-histone cluster 1, H2bj Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H2BJ-histone cluster 1, H2bj Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014312
Product type: DNA & cDNA
Ncbi symbol: HIST1H2BJ
Origin species: Human
Product name: HIST1H2BJ-histone cluster 1, H2bj Gene
Size: 2ug
Accessions: BC014312
Gene id: 8970
Gene description: histone cluster 1, H2bj
Synonyms: H2B/r; H2BFR; H2BJ; histone H2B type 1-J; H2B histone family, member R; histone 1, H2bj; histone H2B.1; histone H2B.r; histone cluster 1, H2bj; histone cluster 1 H2B family member j
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagagccagcgaagtctgctcccgccccgaaaaagggctccaagaaggcggtgactaaggcgcagaagaaagacggcaagaagcgcaagcgcagccgcaaggagagctattccatctatgtgtacaaggttctgaagcaggtccaccctgacaccggcatttcgtccaaggccatgggcatcatgaattcgtttgtgaacgacattttcgagcgcatcgcagggctaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S27-like
- transmembrane protein 216
- dpy-30 homolog (C. elegans)
- transmembrane protein 100

Buy HIST1H2BJ-histone cluster 1, H2bj Gene now

Add to cart