PTXBC011033
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011033 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATG12 |
| Origin species: | Human |
| Product name: | ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC011033 |
| Gene id: | 9140 |
| Gene description: | ATG12 autophagy related 12 homolog (S. cerevisiae) |
| Synonyms: | ATG12 autophagy related 12 homolog; ubiquitin-like protein ATG12; APG12; APG12L; FBR93; HAPG12; APG12 autophagy 12-like; Apg12 (autophagy, yeast) homolog; autophagy related 12 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggagccgcagtctgtgttgcagcttcctacttcaattgctgctggaggggaaggacttacggatgtctccccagaaacaaccaccccggagcccccgtcttccgctgcagtttccccgggaacagaggaacctgctggcgacaccaagaaaaaaatttatttatgtgaatcagtcctttgctccttccccagaccaagaagttggaactctctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - synuclein, gamma (breast cancer-specific protein 1) - adaptor-related protein complex 1, sigma 1 subunit - leucine rich repeat containing 8 family, member D - adaptor-related protein complex 1, sigma 2 subunit |