Login to display prices
Login to display prices
ANAPC13-anaphase promoting complex subunit 13 Gene View larger

ANAPC13-anaphase promoting complex subunit 13 Gene

PTXBC005398

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANAPC13-anaphase promoting complex subunit 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANAPC13-anaphase promoting complex subunit 13 Gene

Proteogenix catalog: PTXBC005398
Ncbi symbol: ANAPC13
Product name: ANAPC13-anaphase promoting complex subunit 13 Gene
Size: 2ug
Accessions: BC005398
Gene id: 25847
Gene description: anaphase promoting complex subunit 13
Synonyms: APC13; SWM1; anaphase-promoting complex subunit 13; cyclosome subunit 13; anaphase promoting complex subunit 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagtgaggttcagagagatggaaggatcttggatttgattgatgatgcttggcgagaagacaagctgccttatgaggatgtcgcaataccactgaatgagcttcctgaacctgaacaagacaatggtggcaccacagaatctgtcaaagaacaagaaatgaagtggacagacttagccttacagtacctccatgagaatgttccccccattggaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: