COL4A6-collagen, type IV, alpha 6 Gene View larger

COL4A6-collagen, type IV, alpha 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COL4A6-collagen, type IV, alpha 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COL4A6-collagen, type IV, alpha 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005305
Product type: DNA & cDNA
Ncbi symbol: COL4A6
Origin species: Human
Product name: COL4A6-collagen, type IV, alpha 6 Gene
Size: 2ug
Accessions: BC005305
Gene id: 1288
Gene description: collagen, type IV, alpha 6
Synonyms: CXDELq22.3; DELXq22.3; DFNX6; collagen alpha-6(IV) chain; collagen IV, alpha-6 polypeptide; collagen of basement membrane, alpha-6; collagen, type IV, alpha 6; dJ889N15.4 (Collagen Alpha 6(IV)); collagen type IV alpha 6 chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttataaacaagttgtggctgctcctggttacgttgtgcctgaccgaggaactggcagcagcgggagagaagtcttatggaaagccatgtgggggccaggactgcagtgggagctgtcagtgttttcctgagaaaggagcgagacacaacttgcagctactgaatgatatggctggccggctctaccatttcagtgaggttctgcctaatctcttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 1, H2bj
- ribosomal protein S27-like
- transmembrane protein 216
- dpy-30 homolog (C. elegans)

Buy COL4A6-collagen, type IV, alpha 6 Gene now

Add to cart