Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of COL4A6-collagen, type IV, alpha 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COL4A6-collagen, type IV, alpha 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005305 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COL4A6 |
| Origin species: | Human |
| Product name: | COL4A6-collagen, type IV, alpha 6 Gene |
| Size: | 2ug |
| Accessions: | BC005305 |
| Gene id: | 1288 |
| Gene description: | collagen, type IV, alpha 6 |
| Synonyms: | CXDELq22.3; DELXq22.3; DFNX6; collagen alpha-6(IV) chain; collagen IV, alpha-6 polypeptide; collagen of basement membrane, alpha-6; collagen, type IV, alpha 6; dJ889N15.4 (Collagen Alpha 6(IV)); collagen type IV alpha 6 chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttataaacaagttgtggctgctcctggttacgttgtgcctgaccgaggaactggcagcagcgggagagaagtcttatggaaagccatgtgggggccaggactgcagtgggagctgtcagtgttttcctgagaaaggagcgagacacaacttgcagctactgaatgatatggctggccggctctaccatttcagtgaggttctgcctaatctcttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H2bj - ribosomal protein S27-like - transmembrane protein 216 - dpy-30 homolog (C. elegans) |