FAM60A-family with sequence similarity 60, member A Gene View larger

FAM60A-family with sequence similarity 60, member A Gene

PTXBC004462

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM60A-family with sequence similarity 60, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM60A-family with sequence similarity 60, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004462
Product type: DNA & cDNA
Ncbi symbol: FAM60A
Origin species: Human
Product name: FAM60A-family with sequence similarity 60, member A Gene
Size: 2ug
Accessions: BC004462
Gene id: 58516
Gene description: family with sequence similarity 60, member A
Synonyms: protein FAM60A; C12orf14; TERA; tera protein homolog; family with sequence similarity 60 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttctggttctaacagaacaccagttttttcctttttagatctcacttactggaaaagacagaagatatgttgtgggatcatctataaaggccgttttggggaagtcctcattgacacacatctcttcaagccttgctgcagcaataagaaagcagctgctgagaagccagaggagcaggggccagagcctctgcccatctccactcaggagtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 32, member A
- family with sequence similarity 96, member B
- peptidylprolyl isomerase (cyclophilin)-like 1
- iron-sulfur cluster scaffold homolog (E. coli)

Buy FAM60A-family with sequence similarity 60, member A Gene now

Add to cart