> >>GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene
GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene View larger

GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene

PTXBC005940

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005940
Product type: DNA & cDNA
Ncbi symbol: GNG12
Origin species: Human
Product name: GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene
Size: 2ug
Accessions: BC005940
Gene id: 55970
Gene description: guanine nucleotide binding protein (G protein), gamma 12
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-12; G-protein gamma-12 subunit; guanine nucleotide binding protein (G protein), gamma 12; G protein subunit gamma 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccagcaaaacagcaagcaccaacaatatagcccaggcaaggagaactgtgcagcagttaagattagaagcctccattgaaggaataaaggtttcgaaggcatcagcggacctcatgtcctactgtgaggaacatgccaggagtgaccctttgctgataggaataccaacttcagaaaaccctttcaaggataaaaaaacttgcatcatcttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal accessory protein 2
- tumor necrosis factor receptor superfamily, member 21
- coiled-coil-helix-coiled-coil-helix domain containing 2
- N-6 adenine-specific DNA methyltransferase 1 (putative)

Reviews

Buy GNG12-guanine nucleotide binding protein (G protein), gamma 12 Gene now

Add to cart