No products
Prices are tax excluded
PTXBC005236
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005236 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM8A |
| Origin species: | Human |
| Product name: | TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC005236 |
| Gene id: | 1678 |
| Gene description: | translocase of inner mitochondrial membrane 8 homolog A (yeast) |
| Synonyms: | DDP; DDP1; DFN1; MTS; TIM8; mitochondrial import inner membrane translocase subunit Tim8 A; X-linked deafness dystonia protein; deafness dystonia protein 1; deafness/dystonia peptide; translocase of inner mitochondrial membrane 8 homolog A (yeast) |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctgaatgacaagtgggtcaatgaagaaattaaaaagaaaattgaaaaatgtcttgaaacaaatgataatggaaacacaacataccaaaacctatgggatacagcaaaagcagtagtgagagggaagtttatagctataagcacctacatcaaaaaagaagaaaaacttcaaataaataatctaaccatgaatcttatagaactagagaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 8 homolog A (yeast) - eukaryotic translation initiation factor 4E binding protein 1 - interleukin 2 receptor, gamma (severe combined immunodeficiency) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa |