TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene View larger

TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene

PTXBC005236

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005236
Product type: DNA & cDNA
Ncbi symbol: TIMM8A
Origin species: Human
Product name: TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene
Size: 2ug
Accessions: BC005236
Gene id: 1678
Gene description: translocase of inner mitochondrial membrane 8 homolog A (yeast)
Synonyms: DDP; DDP1; DFN1; MTS; TIM8; mitochondrial import inner membrane translocase subunit Tim8 A; X-linked deafness dystonia protein; deafness dystonia protein 1; deafness/dystonia peptide; translocase of inner mitochondrial membrane 8 homolog A (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcctgaatgacaagtgggtcaatgaagaaattaaaaagaaaattgaaaaatgtcttgaaacaaatgataatggaaacacaacataccaaaacctatgggatacagcaaaagcagtagtgagagggaagtttatagctataagcacctacatcaaaaaagaagaaaaacttcaaataaataatctaaccatgaatcttatagaactagagaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of inner mitochondrial membrane 8 homolog A (yeast)
- eukaryotic translation initiation factor 4E binding protein 1
- interleukin 2 receptor, gamma (severe combined immunodeficiency)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa

Reviews

Buy TIMM8A-translocase of inner mitochondrial membrane 8 homolog A (yeast) Gene now

Add to cart