MGC70863-similar to RPL23AP7 protein Gene View larger

MGC70863-similar to RPL23AP7 protein Gene

PTXBC019348

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC70863-similar to RPL23AP7 protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC70863-similar to RPL23AP7 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019348
Product type: DNA & cDNA
Ncbi symbol: MGC70863
Origin species: Human
Product name: MGC70863-similar to RPL23AP7 protein Gene
Size: 2ug
Accessions: BC019348
Gene id: 284942
Gene description: similar to RPL23AP7 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggtggcctggacagtgaagggagagaagtggatttgggagacatttaggaggaacagtaagaggaccttgtgcatgaataatttgtttccacactacagaaagaatcccagacttcttagagaacccagtgactttttgcaccttaaatctgtgaaatcctcatgttttcttctgccgtatccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HIG1 domain family, member 1A
- zinc finger family member 673
- gamma-glutamyl cyclotransferase
- hypothetical protein HSPC152

Reviews

Buy MGC70863-similar to RPL23AP7 protein Gene now

Add to cart