C9orf70-chromosome 9 open reading frame 70 Gene View larger

C9orf70-chromosome 9 open reading frame 70 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf70-chromosome 9 open reading frame 70 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf70-chromosome 9 open reading frame 70 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007366
Product type: DNA & cDNA
Ncbi symbol: C9orf70
Origin species: Human
Product name: C9orf70-chromosome 9 open reading frame 70 Gene
Size: 2ug
Accessions: BC007366
Gene id: 84850
Gene description: chromosome 9 open reading frame 70
Synonyms: C9orf70; GLIS3 antisense RNA 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctctgtgctggaccgcaactaagaggacaaaacggaagagacatcgataaggagagccggtccttggaatattttcctgggaaggcatcatgctctatcagtgcaactcagcccacaaaaatttatcaagcagcaactacgggtcctctgaacgggccacaccacggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L33
- chromosome 5 open reading frame 13
- chromosome 5 open reading frame 46
- chromosome 6 open reading frame 48

Buy C9orf70-chromosome 9 open reading frame 70 Gene now

Add to cart