TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene View larger

TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005184
Product type: DNA & cDNA
Ncbi symbol: TRNT1
Origin species: Human
Product name: TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene
Size: 2ug
Accessions: BC005184
Gene id: 51095
Gene description: tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms: CCA1; CGI-47; MtCCA; RPEM; SIFD; CCA tRNA nucleotidyltransferase 1, mitochondrial; ATP(CTP):tRNA nucleotidyltransferase; CCA-adding enzyme; mitochondrial CCA-adding tRNA-nucleotidyltransferase; mt CCA-adding enzyme; mt tRNA CCA-diphosphorylase; mt tRNA CCA-pyrophosphorylase; mt tRNA adenylyltransferase; tRNA CCA nucleotidyl transferase 1; tRNA nucleotidyl transferase, CCA-adding, 1; tRNA-nucleotidyltransferase 1, mitochondrial; tRNA nucleotidyl transferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaggtgcctgtatcattggcacaggccagtgctgaaccgtaggtggagtaggctgtgccttctgaagcagtatctattcacaatgaagttgcagtctcccgaattccagtcacttttcacagaaggactgaagagtctgacaggtataaatgctttccatgagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - presenilin enhancer 2 homolog (C. elegans)
- eukaryotic translation initiation factor 1B
- serine/threonine protein kinase MST4
- ubiquitin-conjugating enzyme E2W (putative)

Buy TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene now

Add to cart