Login to display prices
Login to display prices
EIF1B-eukaryotic translation initiation factor 1B Gene View larger

EIF1B-eukaryotic translation initiation factor 1B Gene

PTXBC006996

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF1B-eukaryotic translation initiation factor 1B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF1B-eukaryotic translation initiation factor 1B Gene

Proteogenix catalog: PTXBC006996
Ncbi symbol: EIF1B
Product name: EIF1B-eukaryotic translation initiation factor 1B Gene
Size: 2ug
Accessions: BC006996
Gene id: 10289
Gene description: eukaryotic translation initiation factor 1B
Synonyms: GC20; eukaryotic translation initiation factor 1b; protein translation factor SUI1 homolog GC20; translation factor sui1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccactatccagaacctccaatctttcgacccctttgctgatgcaactaagggtgacgacttactcccggcagggactgaggattacattcatataagaatccagcaacggaacggcagaaagacactgactactgttcagggcattgcagatgattatgacaaaaagaaacttgtgaaagctttcaaaaagaaatttgcctgtaatggtactgtgattgaacatcctgaatacggagaggttattcagcttcaaggtgaccaaagaaaaaacatctgccagtttctcttggaggttggcattgtaaaggaggaacagcttaaggttcatggattctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: