PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene View larger

PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009575
Product type: DNA & cDNA
Ncbi symbol: PSENEN
Origin species: Human
Product name: PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene
Size: 2ug
Accessions: BC009575
Gene id: 55851
Gene description: presenilin enhancer 2 homolog (C. elegans)
Synonyms: MDS033; MSTP064; PEN-2; PEN2; gamma-secretase subunit PEN-2; hematopoietic stem/progenitor cells protein MDS033; presenilin enhancer 2 homolog; presenilin enhancer gamma-secretase subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacctggagcgagtgtccaatgaggagaaattgaacctgtgccggaagtactacctgggggggtttgctttcctgccttttctctggttggtcaacatcttctggttcttccgagaggccttccttgtcccagcctacacagaacagagccaaatcaaaggctatgtctggcgctcagctgtgggcttcctcttctgggtgatagtgctcacctcctggatcaccatcttccagatctaccggccccgctggggtgcccttggggactacctctccttcaccatacccctgggcaccccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 1B
- serine/threonine protein kinase MST4
- ubiquitin-conjugating enzyme E2W (putative)
- angiotensin II receptor-associated protein

Buy PSENEN-presenilin enhancer 2 homolog (C. elegans) Gene now

Add to cart