LOC158435-hypothetical protein BC008050 Gene View larger

LOC158435-hypothetical protein BC008050 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC158435-hypothetical protein BC008050 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC158435-hypothetical protein BC008050 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008050
Product type: DNA & cDNA
Ncbi symbol: LOC158435
Origin species: Human
Product name: LOC158435-hypothetical protein BC008050 Gene
Size: 2ug
Accessions: BC008050
Gene id: 158435
Gene description: hypothetical protein BC008050
Synonyms: uncharacterized LOC158435; uncharacterized protein LOC158435
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatttgcagcaggctggtggaggcagagcagagaagggcgggagagggccagcgaaggcctgggaaggtggacccacaaactcgtctcctaatgaagctaaccagcaatgcgagggcacacagggagaccccctagaggctgccccaggccaggagtcacctgtgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB7B, member RAS oncogene family
- cysteine-rich PDZ-binding protein
- peptidase inhibitor 3, skin-derived
- shisa homolog 5 (Xenopus laevis)

Buy LOC158435-hypothetical protein BC008050 Gene now

Add to cart