RAB7B-RAB7B, member RAS oncogene family Gene View larger

RAB7B-RAB7B, member RAS oncogene family Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB7B-RAB7B, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB7B-RAB7B, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007382
Product type: DNA & cDNA
Ncbi symbol: RAB7B
Origin species: Human
Product name: RAB7B-RAB7B, member RAS oncogene family Gene
Size: 2ug
Accessions: BC007382
Gene id: 338382
Gene description: RAB7B, member RAS oncogene family
Synonyms: RAB7B, member RAS oncogene family; RAB7; ras-related protein Rab-7b; Ras-related protein Rab-7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccagcacgggaacaggggggcagcctagagcacaagctctatctgtgtccttcagagctcctgggaaacatgatgcgccctcatgggaatggcattttgcatatcacacaggctgtcctgggagtcaggcagactggattgtcacgtgcggtgtgcatgcagcagcttgtgcactgcagtggacctgtggaccatttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine-rich PDZ-binding protein
- peptidase inhibitor 3, skin-derived
- shisa homolog 5 (Xenopus laevis)
- signal recognition particle 19kDa

Buy RAB7B-RAB7B, member RAS oncogene family Gene now

Add to cart