TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene View larger

TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene

PTXBC000711

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000711
Product type: DNA & cDNA
Ncbi symbol: TIMM8B
Origin species: Human
Product name: TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene
Size: 2ug
Accessions: BC000711
Gene id: 26521
Gene description: translocase of inner mitochondrial membrane 8 homolog B (yeast)
Synonyms: DDP2; TIM8B; mitochondrial import inner membrane translocase subunit Tim8 B; DDP-like protein; deafness dystonia protein 2; translocase of inner mitochondrial membrane 8 homolog B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttatgttgggataaatgtgtggagaagccagggaatcgcctagactctcgcactgaaaattgtctctccagctgtgtagaccgcttcattgacaccactcttgccatcaccagtcggtttgcccagattgtacagaaaggagggcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of inner mitochondrial membrane 8 homolog A (yeast)
- translocase of inner mitochondrial membrane 8 homolog A (yeast)
- eukaryotic translation initiation factor 4E binding protein 1
- interleukin 2 receptor, gamma (severe combined immunodeficiency)

Buy TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene now

Add to cart