MORN4-MORN repeat containing 4 Gene View larger

MORN4-MORN repeat containing 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MORN4-MORN repeat containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MORN4-MORN repeat containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022054
Product type: DNA & cDNA
Ncbi symbol: MORN4
Origin species: Human
Product name: MORN4-MORN repeat containing 4 Gene
Size: 2ug
Accessions: BC022054
Gene id: 118812
Gene description: MORN repeat containing 4
Synonyms: C10orf83; bA548K23.4; rtp; MORN repeat-containing protein 4; 44050 protein; protein 44050; retinophilin; retinophilin homolog; MORN repeat containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgacaaaaggttccttcacctactccagtggggaggaatatcgtggcgagtggaaggagggtgagaaggacccctggggagtatccatgatgaacacttcatttgctggaggacaaatacatcaggatatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-fold modifier 1
- zinc finger protein 626
- HERV-H LTR-associating 3
- zinc finger protein 587

Buy MORN4-MORN repeat containing 4 Gene now

Add to cart