Login to display prices
Login to display prices
MORN4-MORN repeat containing 4 Gene View larger

MORN4-MORN repeat containing 4 Gene

PTXBC022054

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MORN4-MORN repeat containing 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MORN4-MORN repeat containing 4 Gene

Proteogenix catalog: PTXBC022054
Ncbi symbol: MORN4
Product name: MORN4-MORN repeat containing 4 Gene
Size: 2ug
Accessions: BC022054
Gene id: 118812
Gene description: MORN repeat containing 4
Synonyms: C10orf83; bA548K23.4; rtp; MORN repeat-containing protein 4; 44050 protein; protein 44050; retinophilin; retinophilin homolog; MORN repeat containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgacaaaaggttccttcacctactccagtggggaggaatatcgtggcgagtggaaggagggtgagaaggacccctggggagtatccatgatgaacacttcatttgctggaggacaaatacatcaggatatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: