Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene
PTXBC018700
New product
Data sheet of CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018700 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTF8 |
| Origin species: | Human |
| Product name: | CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC018700 |
| Gene id: | 54921 |
| Gene description: | chromosome transmission fidelity factor 8 homolog (S. cerevisiae) |
| Synonyms: | CTF8, chromosome transmission fidelity factor 8 homolog; CTF8; DERPC; chromosome transmission fidelity protein 8 homolog; decreased expression in renal and prostate cancer protein; chromosome transmission fidelity factor 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatggccctgcaggcaagagtttcgtcccatttcctagagtggggagcctccctggcacaaacccagctgctttccccagaccagggggtccaatggctgcaatgtacccaaatggaatgttgcccccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 8 homolog B (yeast) - translocase of inner mitochondrial membrane 8 homolog A (yeast) - translocase of inner mitochondrial membrane 8 homolog A (yeast) - eukaryotic translation initiation factor 4E binding protein 1 |