CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene View larger

CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018700
Product type: DNA & cDNA
Ncbi symbol: CTF8
Origin species: Human
Product name: CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC018700
Gene id: 54921
Gene description: chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Synonyms: CTF8, chromosome transmission fidelity factor 8 homolog; CTF8; DERPC; chromosome transmission fidelity protein 8 homolog; decreased expression in renal and prostate cancer protein; chromosome transmission fidelity factor 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatggccctgcaggcaagagtttcgtcccatttcctagagtggggagcctccctggcacaaacccagctgctttccccagaccagggggtccaatggctgcaatgtacccaaatggaatgttgcccccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of inner mitochondrial membrane 8 homolog B (yeast)
- translocase of inner mitochondrial membrane 8 homolog A (yeast)
- translocase of inner mitochondrial membrane 8 homolog A (yeast)
- eukaryotic translation initiation factor 4E binding protein 1

Buy CTF8-chromosome transmission fidelity factor 8 homolog (S. cerevisiae) Gene now

Add to cart