TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene View larger

TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene

PTXBC018133

New product

Data sheet of TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC018133
Product type: DNA & cDNA
Ncbi symbol: TCIRG1
Origin species: Human
Product name: TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene
Size: 2ug
Accessions: BC018133
Gene id: 10312
Gene description: T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Synonyms: ATP6N1C; ATP6V0A3; Atp6i; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1; V-type proton ATPase 116 kDa subunit a isoform 3; ATPase, H+ transporting, 116kD; OC-116 kDa; T-cell immune response cDNA 7; T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a; T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3; V-ATPase 116-kDa; V-type proton ATPase 116 kDa subunit a; osteoclastic proton pump 116 kDa subunit; specific 116-kDa vacuolar proton pump subunit; vacuolar proton translocating ATPase 116 kDa subunit A; T-cell immune regulator 1, ATPase H+ transporting V0 subunit a3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctccatgttccggagcgaggaggtggccctggtccagctctttctgcccacagcggctgcctacacctgcgtgagtcggctgggcgagctgggcctcgtggagttcagagacctcaacgcctcggtgagcgccttccagagacgctttgtggttgatgttcggcgctgtgaggagctggagaagaccttcaccttcctgcaggaggaggtgcggcgggctgggctggtcctgcccccgccaaaggggaggctgccggcacccccaccccgggacctgctgcgcatccaggaggagacggagcgcctggcccaggagctgcgggatgtgcggggcaaccagcaggccctgcgggcccagctgcaccagctgcagctccacgccgccgtgctacgccagggccatgaacctcagctggcagccgcccacacagatggggcctcagagaggacgcccctgctccaggcccccggggggccgcaccaggacctgagggtcaactttgtggcaggtgccgtggagccccacaaggcccctgccctagagcgcctgctctggagggcctgccgcggcttcctcattgccagcttcagggagctggagcagccgctggagcaccccgtgacgggcgagccagccacgtggatgaccttcctcatctcctactggggtgagcagatcggacagaagatccgcaagatcacggactgcttccactgccacgtcttcccgtttctgcagcaggaggaggcccgcctcggggccctgcagcagctgcaacagcagagccaggagctgcaggaggtcctcggggagacagagcggttcctgagccaggtgctaggccgggtgctgcagctgctgccgccagggcaggtgcaggtccacaagatgaaggccgtgtacctggccctgaaccagtgcagcgtgagcaccacgcacaagtgcctcattgccgaggcctggtgctctgtgcgagacctgcccgccctgcaggaggccctgcgggacagctcgatggaggagggagtgagtgccgtggctcaccgcatcccctgccgggacatgccccccacactcatccgcaccaaccgcttcacggccagcttccagggcatcgtggatgcctacggcgtgggccgctaccaggaggtcaaccccgctccctacaccatcatcaccttccccttcctgtttgctgtgatgttcggggatgtgggccacgggctgctcatgttcctcttcgccctggccatggtccttgcggagaaccgaccggctgtgaaggccgcgcagaacgagatctggcagactttcttcaggggccgctacctgctcctgcttatgggcctgttctccatctacaccggcttcatctacaacgagtgcttcagtcgcgccaccagcatcttcccctcgggctggagtgtggccgccatggccaaccagtctggctggagtgatgcattcctggcccagcacacgatgcttaccctggatcccaacgtcaccggtgtcttcctgggaccctacccctttggcatcgatcctatttggagcctggctgccaaccacttgagcttcctcaactccttcaagatgaagatgtccgtcatcctgggcgtcgtgcacatggcctttggggtggtcctcggagtcttcaaccacgtgcactttggccagaggcaccggctgctgctggagacgctgccggagctcaccttcctgctgggactcttcggttacctcgtgttcctagtcatctacaagtggctgtgtgtctgggctgccagggccgcctcggcccccagcatcctcatccacttcatcaacatgttcctcttctcccacagccccagcaacaggctgctctacccccggcaggaggtggtccaggccacgctggtggtcctggccttggccatggtgcccatcctgctgcttggcacacccctgcacctgctgcaccgccaccgccgccgcctgcggaggaggcccgctgaccgacaggaggaaaacaaggccgggttgctggacctgcctgacgcatctgtgaatggctggagctccgatgaggaaaaggcagggggcctggatgatgaagaggaggccgagctcgtcccctccgaggtgctcatgcaccaggccatccacaccatcgagttctgcctgggctgcgtctccaacaccgcctcctacctgcgcctgtgggccctgagcctggcccacgcccagctgtccgaggttctgtgggccatggtgatgcgcataggcctgggcctgggccgggaggtgggcgtggcggctgtggtgctggtccccatctttgccgcctttgccgtgatgaccgtggctatcctgctggtgatggagggactctcagccttcctgcacgccctgcggctgcactgggtggaattccagaacaagttctactcaggcacgggctacaagctgagtcccttcaccttcgctgccacagatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
- platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa
- hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)

Buy TCIRG1-T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 Gene now

Add to cart