Login to display prices
Login to display prices
TAF1C-TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Gene View larger

TAF1C-TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Gene

PTXBC028131

New product

Data sheet of TAF1C-TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAF1C-TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC028131
Ncbi symbol: TAF1C
Product name: TAF1C-TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Gene
Size: 2ug
Accessions: BC028131
Gene id: 9013
Gene description: TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa
Synonyms: MGC:39976; SL1; TAFI110; TAFI95; TATA box-binding protein-associated factor RNA polymerase I subunit C; RNA polymerase I-specific TBP-associated factor 110 kDa; SL1, 110kD subunit; TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD; TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa; TATA box-binding protein-associated factor 1C; TATA-box binding protein associated factor, RNA polymerase I, C; TBP-associated factor 1C; transcription factor SL1; transcription initiation factor SL1/TIF-IB subunit C; TATA-box binding protein associated factor, RNA polymerase I subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcctcccctcatcgatccctgggaccctggcctgactgcccgggacctgcttttccgcggagggtaccggtatcggaagcggccccgagtcgtgctggatgtgactgagcagatcagccggttcctcttggatcatggagacgtagcctttgcgcccctggggaagctgatgctggagaatttcaagctggagggagcggggagccgcactaagaagaagacagtggtcagtgtgaagaagctgctccaggacctcggtggacaccagccctgggggtgtccctgggcttacctcagcaaccgacagcgccgcttctctatcctcgggggccccatcctgggcacgtcggtggcgagccacttggcagagctgctgcacgaggagctggtgctgcggtgggagcagctgcttctggatgaggcctgcactgggggcgcgctggcctgggttcctggaaggacaccccagttcgggcagctggtctaccctgctggaggcgcccaggacaggctgcatttccaagaggtcgttctgaccccaggtgacaatccccaattccttgggaaacctggacgcatccagctccagggacctgtccggcaagtggtgacatgcaccgtccagggagaaactctgctggccgtccgctctgactaccactgtgccgtgtggaagtttggtaaacagtggcagccaacccttctgcaggcgatgcaggtggagaaaggggccacggggatcagcctcagccctcacctgcccggggagctggccatctgcagccgctcgggagccgtctgcctgtggagccctgaggatgggctgcggcaaatctacagggaccctgagaccctcgtgttccgggactcctcttcgtggcgttgggcagacttcactgcgcaccctcgggtgctgaccgtgggtgaccgcaccggagtgaagatgctggacactcagggcccgccgggctgtggtctgttgctttttcgtttgggggcagaggcttcgtgccagaaaggggaacgtgtcctgcttacccagtacctggggcactccagccccaaatgcctcccccctactcttcatctcgtctgtacccagttctctctctacctagtggacgagcgccttcccctggtgccgatgctgaagtggaaccatggcctcccctccccgctcctgctggcccgactgctgcctccgccccggcccagctgcgtgcagcccctgctcctcggaggccagggtgggcagctgcagctgctgcacctggcagaaggggcgtcggtgccccgcctggcaggccccccccagtctcttccttccaggatcgactccctccctgcatttcctctgctggagcctaagatccagtggcggctgcaggagcgcctgaaagcaccgaccataggtctggctgccgtcgtcccgcccatgccctcagcgcccacaccaggcctggtgctcttccagctctcggcggcgggagatgtcttctaccagcagctccgcccccaggtggactccagcctccgcagagatgctgggcctcctggcgacacccaacctgactgccatgcccccacagcttcctggacctcccaggacactgccggctgcagccagtggctgaaggccctgctaaaagtgcccctggctcctcctgtgtggacagcacccaccttcacccaccgccagatgctgggcagcacagagctgcggagggaggaagaggaagggcagcggctgggtgtactccgcaaggccatggcccgagggcagctcctgctgcagagagacctgggctccctccctgcggcagagccaccccctgcacccgagtcaggcctagaggacaagctcagtgagcgcctgggggaagcctgggcaggccgaggggctgcctggtgggagaggcagcagggcaggacctcggagcccgggagacagaccaggcggcccaagcgccggacccagctgtccagcagcttttcgctcagtggccatgtggatccctcagaggacaccagctcccctcatagccctgagtggccacctgctgatgctctgcccctgccccccacgaccccgccctcccaggagttgactccggatgcatgcgcccagggcgtcccatcagagcagcggcagatgctccgtgactacatggccaagctaccaccccagagggacaccccaggctgtgccaccacacctccccactcccaggcctccagcgtccgggccactcgctcccagcagcacacacccgtcctctctagctctcagcccctccgtaagaagcctcgaatgggcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: