ZBTB8-zinc finger and BTB domain containing 8 Gene View larger

ZBTB8-zinc finger and BTB domain containing 8 Gene

PTXBC015239

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZBTB8-zinc finger and BTB domain containing 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB8-zinc finger and BTB domain containing 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015239
Product type: DNA & cDNA
Ncbi symbol: ZBTB8
Origin species: Human
Product name: ZBTB8-zinc finger and BTB domain containing 8 Gene
Size: 2ug
Accessions: BC015239
Gene id: 653121
Gene description: zinc finger and BTB domain containing 8
Synonyms: ZBTB8; BOZF1; ZNF916A; zinc finger and BTB domain-containing protein 8A; BTB/POZ and zinc-finger domain-containing factor; BTB/POZ and zinc-finger domains factor on chromosome 1; zinc finger and BTB domain containing 8; zinc finger and BTB domain containing 8A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagatctcctctcatcagtctcacctcctgcagcaactgaacgagcagcgcaggcaagatgtattttgtgactgcagtattctagttgaagggaaggtcttcaaagcacatcgaaatgtattattcgctagtagcggctactttaaaatgcttctttctcagaattcaaaggagacgagtcagccaaccacagctacatttcaggctttctcccctgacacttttacagttatcttggacttcgtatattctggcaaactgtctcttactggtcagaatgtcatagaagtgatgtcggctgctagcttccttcagatgactgatgtcataagtgtatgtaagacttttattaaatcttccttagacattagtgagaaagaaaaagatcgctatttcagtctctcagataaagatgccaattctaatggtgtagaacgttcctctttttatagtggtggctggcaagaaggaagcagttctccacgttctcacctaagcccagagcaaggaacaggtataataagtggaaaatcttggaataagtataattatcatccagcctcccagaagaatactcaacaacccttggccaagcatgaaccaaggaaagagtccattaaaaagaccaaacatttgagattgtcacagccttctgaagttactcattataagtcaagcaaacgagaagtacgaacatctgattcttccagccatgtttcccagtctgaagaacaagcacagattgatgctgaaatggactctactcctgttggctatcagtacggtcaaggatctgatgtcacatccaaaagctttccagatgatctgcctcggatgcgattcaagtgcccgtactgcacacatgtggtgaagcggaaggcagacctaaagcgccaccttcgttgtcatacaggagaaaggccctatccatgtcaagcttgtggaaaaagatttagcaggctagaccatctaagtagccattttcgaacaattcaccaggcatgtaaactcatctgcagaaaatgtaaacgtcatgtgacagatctaacagggcaagtggtacaggagggaaccaggcgctacagactgtgtaatgagtgtcttgcagaatttggcatagacagcctccccattgacttggaagctgaacaacatcttatgtccccatcagatggagataaggattccagatggcacttgagtgaagatgagaatagatcctatgtggagattgtagaagatgggtctgctgatctggtcatccaacaggttgatgatagtgaagaagaagaagaaaaagaaattaagcccaacattaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM14A, SCD6 homolog A (S. cerevisiae)
- suppressor of fused homolog (Drosophila)
- heat shock 60kDa protein 1 (chaperonin)
- enhancer of zeste homolog 1 (Drosophila)

Buy ZBTB8-zinc finger and BTB domain containing 8 Gene now

Add to cart