HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene View larger

HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene


New product

Data sheet of HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002676
Product type: DNA & cDNA
Ncbi symbol: HSPD1
Origin species: Human
Product name: HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene
Size: 2ug
Accessions: BC002676
Gene id: 3329
Gene description: heat shock 60kDa protein 1 (chaperonin)
Synonyms: CPN60; GROEL; HLD4; HSP-60; HSP65; HuCHA60; SPG13; 60 kDa heat shock protein, mitochondrial; 60 kDa chaperonin; P60 lymphocyte protein; chaperonin 60; heat shock 60kDa protein 1 (chaperonin); heat shock protein 65; mitochondrial matrix protein P1; short heat shock protein 60 Hsp60s1; heat shock protein family D (Hsp60) member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcactcgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagggaagaacagtgattattgagcagagttggggaagtcccaaagtaacaaaagatggtgtgactgttgcaaagtcaattgacttaaaagataaatacaaaaacattggagctaaacttgttcaagatgttgccaataacacaaatgaagaagctggggatggcactaccactgctactgtactggcacgctctatagccaaggaaggcttcgagaagattagcaaaggtgctaatccagtggaaatcaggagaggtgtgatgttagctgttgatgctgtaattgctgaacttaaaaagcagtctaaacctgtgaccacccctgaagaaattgcacaggttgctacgatttctgcaaacggagacaaagaaattggcaatatcatctctgatgcaatgaaaaaagttggaagaaagggtgtcatcacagtaaaggatggaaaaacactgaatgatgaattagaaattattgaaggcatgaagtttgatcgaggctatatttctccatactttattaatacatcaaaaggtcagaaatgtgaattccaggatgcctatgttctgttgagtgaaaagaaaatttctagtatccagtccattgtacctgctcttgaaattgccaatgctcaccgtaagcctttggtcataatcgctgaagatgttgatggagaagctctaagtacactcgtcttgaataggctaaaggttggtcttcaggttgtggcagtcaaggctccagggtttggtgacaatagaaagaaccagcttaaagatatggctattgctactggtggtgcagtgtttggagaagagggattgaccctgaatcttgaagacgttcagcctcatgacttaggaaaagttggagaggtcattgtgaccaaagacgatgccatgctcttaaaaggaaaaggtgacaaggctcaaattgaaaaacgtattcaagaaatcattgagcagttagatgtcacaactagtgaatatgaaaaggaaaaactgaatgaacggcttgcaaaactttcagatggagtggctgtgctgaaggttggtgggacaagtgatgttgaagtgaatgaaaagaaagacagagttacagatgcccttaatgctacaagagctgctgttgaagaaggcattgttttgggagggggttgtgccctccttcgatgcattccagccttggactcattgactccagctaatgaagatcaaaaaattggtatagaaattattaaaagaacactcaaaattccagcaatgaccattgctaagaatgcaggtgttgaaggatctttgatagttgagaaaattatgcaaagttcctcagaagttggttatgatgctatggctggagattttgtgaatatggtggaaaaaggaatcattgacccaacaaaggttgtgagaactgctttattggatgctgctggtgtggcctctctgttaactacagcagaagttgtagtcacagaaattcctaaagaagagaaggaccctggaatgggtgcaatgggtggaatgggaggtggtatgggaggtggcatgttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - enhancer of zeste homolog 1 (Drosophila)
- RAB GTPase activating protein 1-like
- anaphase promoting complex subunit 13
- X antigen family, member 2-like

Buy HSPD1-heat shock 60kDa protein 1 (chaperonin) Gene now

Add to cart