LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene View larger

LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016842
Product type: DNA & cDNA
Ncbi symbol: LSM14A
Origin species: Human
Product name: LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016842
Gene id: 26065
Gene description: LSM14A, SCD6 homolog A (S. cerevisiae)
Synonyms: LSM14A, mRNA processing body assembly factor; LSM14A, SCD6 homolog A; C19orf13; FAM61A; RAP55A; protein LSM14 homolog A; LSM14 homolog A; RNA-associated protein 55; RNA-associated protein 55A; alphaSNBP; family with sequence similarity 61, member A; hRAP55; hRAP55A; protein SCD6 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgggggcaccccttacatcggcagcaagatcagcctcatctccaaggcggagatccgctacgagggcatcctctacaccatcgacaccgaaaactccaccgtagcccttgccaaagttcgatcctttggtacagaagacagaccgacagatcgtccaataccacctcgagatgaagtctttgaatacattatattccgtgggagtgacattaaagaccttactgtttgtgagccaccaaaaccacagtgttctttgcctcaagacccagctattgttcagtcctcactaggctcatcgacttcttcattccagtccatgggttcttatggacctttcggcaggatgcccacatacagtcagttcagtccgagttccttagttgggcagcagtttggtgctgttggtgttgctggaagctctttgacatcctttggaacagaaacatcaaacagtggtaccttaccccaaagtagtgcggttggttctgcctttacacaggatacaagatctctaaaaacacagttatctcaaggtcgctcaagccctcagttagaccctttgagaaaaagcccaaccatggaacaagcagtgcagaccgcctcagcccacttacctgctccagcagctgttgggagaaggagtcctgtatcaaccaggcctttgccatctgccagccaaaaggcaggagagaatcaggagcacaggcgagctgaagtacacaaagtttcaaggccagaaaatgagcaactcagaaatgataacaagagacaagtagctccaggtgctccttcagctccaaggagagggcgtgggggtcatcggggtggcaggggaagatttggtattcggcgagatgggccaatgaaatttgagaaagactttgactttgaaagtgcaaatgcacaattcaacaaggaagagattgacagagagtttcataataaacttaaattaaaagaagataaacttgagaaacaggagaagcctgtaaatggtgaagataaaggagactcaggagttgatacccaaaacagtgaaggaaatgccgatgaagaagatccacttggacctaattgctattatgacaaaactaaatccttctttgataatatttcttgtgatgacaatagagaacggagaccaacctgggctgaagaaagaagattaaatgctgaaacatttggaatcccacttcgtccaaaccgtggccgtgggggatacagaggcagaggaggtcttggtttccgtggtggcagagggcgtggtggtggcagaggtggtaccttcactgcccctcgaggatttcgcggtggattcagaggaggtcgtgggggccgggagtttgcggattttgaatataggaaagacaacaaagttgctgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - suppressor of fused homolog (Drosophila)
- heat shock 60kDa protein 1 (chaperonin)
- enhancer of zeste homolog 1 (Drosophila)
- RAB GTPase activating protein 1-like

Buy LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene now

Add to cart