Login to display prices
Login to display prices
LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene View larger

LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene

PTXBC016842

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene

Proteogenix catalog: PTXBC016842
Ncbi symbol: LSM14A
Product name: LSM14A-LSM14A, SCD6 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016842
Gene id: 26065
Gene description: LSM14A, SCD6 homolog A (S. cerevisiae)
Synonyms: LSM14A, mRNA processing body assembly factor; LSM14A, SCD6 homolog A; C19orf13; FAM61A; RAP55A; protein LSM14 homolog A; LSM14 homolog A; RNA-associated protein 55; RNA-associated protein 55A; alphaSNBP; family with sequence similarity 61, member A; hRAP55; hRAP55A; protein SCD6 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgggggcaccccttacatcggcagcaagatcagcctcatctccaaggcggagatccgctacgagggcatcctctacaccatcgacaccgaaaactccaccgtagcccttgccaaagttcgatcctttggtacagaagacagaccgacagatcgtccaataccacctcgagatgaagtctttgaatacattatattccgtgggagtgacattaaagaccttactgtttgtgagccaccaaaaccacagtgttctttgcctcaagacccagctattgttcagtcctcactaggctcatcgacttcttcattccagtccatgggttcttatggacctttcggcaggatgcccacatacagtcagttcagtccgagttccttagttgggcagcagtttggtgctgttggtgttgctggaagctctttgacatcctttggaacagaaacatcaaacagtggtaccttaccccaaagtagtgcggttggttctgcctttacacaggatacaagatctctaaaaacacagttatctcaaggtcgctcaagccctcagttagaccctttgagaaaaagcccaaccatggaacaagcagtgcagaccgcctcagcccacttacctgctccagcagctgttgggagaaggagtcctgtatcaaccaggcctttgccatctgccagccaaaaggcaggagagaatcaggagcacaggcgagctgaagtacacaaagtttcaaggccagaaaatgagcaactcagaaatgataacaagagacaagtagctccaggtgctccttcagctccaaggagagggcgtgggggtcatcggggtggcaggggaagatttggtattcggcgagatgggccaatgaaatttgagaaagactttgactttgaaagtgcaaatgcacaattcaacaaggaagagattgacagagagtttcataataaacttaaattaaaagaagataaacttgagaaacaggagaagcctgtaaatggtgaagataaaggagactcaggagttgatacccaaaacagtgaaggaaatgccgatgaagaagatccacttggacctaattgctattatgacaaaactaaatccttctttgataatatttcttgtgatgacaatagagaacggagaccaacctgggctgaagaaagaagattaaatgctgaaacatttggaatcccacttcgtccaaaccgtggccgtgggggatacagaggcagaggaggtcttggtttccgtggtggcagagggcgtggtggtggcagaggtggtaccttcactgcccctcgaggatttcgcggtggattcagaggaggtcgtgggggccgggagtttgcggattttgaatataggaaagacaacaaagttgctgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: