Cart 10 Product Products 1 300,90 € (empty)
-
1 x C9orf11-ch...113,40 € -
1 x MLLT11-mye...113,40 € -
1 x MGC31957-h...113,40 € -
1 x KDELR3-KDE...113,40 € -
1 x PARD6A-par...121,50 € -
1 x TMEM144-tr...121,50 € -
-
1 x KLK2-kalli...113,40 € -
1 x LUC7L-LUC7...121,50 € -
1 x LSM14B-LSM...113,40 €
No products
To be determined Shipping
1 300,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 300,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 300,90 €
View larger 
Data sheet of SUFU-suppressor of fused homolog (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUFU-suppressor of fused homolog (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013291 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUFU |
| Origin species: | Human |
| Product name: | SUFU-suppressor of fused homolog (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC013291 |
| Gene id: | 51684 |
| Gene description: | suppressor of fused homolog (Drosophila) |
| Synonyms: | SUFU negative regulator of hedgehog signaling; PRO1280; SUFUH; SUFUXL; suppressor of fused homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagctgcggcctagcggcgcccccggccccaccgcgcccccggcccctggcccgactgcccccccggccttcgcttcgctctttcccccgggactgcacgccatctacggagagtgccgccgcctttaccctgaccagccgaacccgctccaggttaccgctatcgtcaagtactggttgggtggcccagaccccttggactatgttagcatgtacaggaatgtggggagcccttctgctaacatccccgagcactggcactacatcagcttcggcctgagtgatctctatggtgacaacagagtccatgagtttacaggaacagatggacctagtggttttggctttgagttgacctttcgtctgaagagagaaactggggagtctgccccaccaacatggcccgcagagttaatgcagggcttggcacgatacgtgttccagtcagagaacaccttctgcagtggggaccatgtgtcctggcacagccctttggataacagtgagtcaagaattcagcacatgctgctgacagaggacccacagatgcagcccgtgcagacaccctttggggtagttaccttcctccagatcgttggtgtctgcactgaagagctacactcagcccagcagtggaacgggcagggcatcctggagctgctgcggacagtgcctattgctggcggcccctggctgataactgacatgcggaggggagagaccatatttgagatcgatccacacctgcaagagagagttgacaaaggcatcgagacagatggctccaacctgagtggtgtcagtgccaagtgtgcctgggatgacctgagccggccccccgaggatgacgaggacagccggagcatctgcatcggcacacagccccggcgactctctggcaaagacacagagcagatccgggagaccctgaggagaggactcgagatcaacagcaaacctgtccttccaccaatcaaccctcagcggcagaatggcctcgcccacgaccgggccccgagccgcaaagacagcctggaaagtgacagctccacggccatcattccccatgagctgattcgcacgcggcagcttgagagcgtacatctgaaattcaaccaggagtccggagccctcattcctctctgcctaaggggcaggctcctgcatggacggcactttacatataaaagtatcacaggtgacatggccatcacgtttgtctccacgggagtggaaggcgcctttgccactgaggagcatccttacgcggctcatggaccctggttacaaattctgttgaccgaagagtttgtagagaaaatgttggaggatttagaagatttgacttctccagaggaattcaaacttcccaaagagtacagctggcctgaaaagaagctgaaggtctccatcctgcctgacgtggtgttcgacagtccgctacactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock 60kDa protein 1 (chaperonin) - enhancer of zeste homolog 1 (Drosophila) - RAB GTPase activating protein 1-like - anaphase promoting complex subunit 13 |